How much Do you Like My Blogs

Monday, 9 February 2015

A study to correlate histopathology, biochemical marker and immunohistochemical expression of sex-steroid receptors in prostatic growth

Indian Journal of Medical and Paediatric Oncology, Vol. 35, No. 1, January-March, 2014, pp. 40-43
Original Article
1 Department Pathology, Medical College, Kolkata, West Bengal, India
2 Department Pathology, School of Tropical Medicine, Kolkata, West Bengal, India
3 Consultant in Nuclear Medicine, R.N. Tagore Institute of Cardiac Sciences, Kolkata, West Bengal, India
4 Department of Urology, IPGMER and SSKM Hospital, Kolkata, West Bengal, India
5 Department Pathology, Calcutta National Medical College, Kolkata, West Bengal, India

Correspondence Address:
Nirmal Kumar Bhattacharyya
Flat-4A, Shanti Apartment, 7/3, Motijheel Avenue, Kolkata - 700 074, West Bengal
India
drnbhattacharya@yahoo.co.in
[Please note here that Dr. Nirmal Kumar Bhattacharya and  Dr Soumya Kanti kundu  are Ghost authors or Fraud authors  in this article and  they had no connection with this work, neither they were related with this work ever .This work was MD(pathology) Thesis of West Bengal University  of Health Sciences (2007-2010) by Dr. Sukla Naskar  under Guidance of Professor Dr Pranab kumar Bhattacharya  then Additional Professor  Pathology IPGMER Kolkata  and Professor Dr Anup kundu Professor of Urology IPGMER----> Professor Dr Pranab kumar Bhattacharya]  

DOI: 10.4103/0971-5851.133719

Abstract
Prostate gland is a fibromusculoglandular structure situated at the neck of urinary bladder. So, enlargement or growth of prostate due to nodular hyperplasia (NHP) or prostatic intraepithelial neoplasia (PIN) or adenocarcinoma may give rise to bladder outlet obstruction. Malignant growth i.e., PIN or adenocarcinoma cases are associated with increased blood level of prostate-specific antigen (PSA) and increased expression of different sex-steroid receptors because the growth is dependent on the interactions of androgen, progesterone and estrogen. The aim of our study is to correlate the histopathology, PSA levels and expression of different sex-steroid receptors by immunohistochemistry in different prostatic growth lesions. Among the total 50 cases received, inclusive of transurethral resection of prostate (TURP), transrectal ultrasound-guided biopsy and radical prostatectomy, 34 cases were diagnosed as NHP, 4 cases as PIN and 12 cases as adenocarcinoma histopathologically. Serum PSA values above 10 ng/ml were seen in 2 cases of PIN and 11 cases of adenocarcinoma and none of NHP. Estrogen receptor (ER) () expressions were negative in all cases. Progesterone receptor (PR) expressions were strongly positive in 35% cases of both NHP and adenocarcinoma, whereas androgen receptor (AR) expressions were strong among all cases of adenocarcinoma and only in four cases of NHP. By observing these findings it can be suggested that antiandrogen and antiprogesterone therapy simultaneously will do better than antiandrogen alone in treating prostatic growth lesions.

Keywords: Androgen receptor, immunohistochemistry, progesterone receptor, prostatic growth, prostate-specific antigen

Introduction

Prostate is a fibromusculoglandular organ encircling the neck of the bladder and male urethra, weighing up to 20 g in normal adults. Anatomically, it has four distinct zones - peripheral, central, transitional and anterior fibromuscular stroma. Hyperplasia arises from the transitional zone and carcinoma from the peripheral zone. [1]
Prostatic enlargement or growth most commonly occurs due to nodular hyperplasia or due to neoplasia like adenocarcinoma of tubuloalveolar glands and also its precursor lesions - prostatic intraepithelial lesion (PIN). All these conditions arise in males after 50 years of age and are due to the effect of androgen released from testis. All these conditions cause bladder outlet obstruction giving rise to different clinical features like dysuria, retention of urine and eneuresis. Low-back pain due to vertebral metastasis is common in the late stage of prostatic carcinoma. This malignancy, though uncommon in Asian countries, the incidence is increasing in our country 1% every year. The incidence of PIN is even higher, approximately 70% above the 70 years of age. [2] To detect early this commonly occurring malignancy in men, screening tests are considered after the age of 40 years, which include digital rectal examination (DRE), transrectal ultrasonography (TRUS) and estimation of prostate-specific antigen (PSA) in serum. [3] PSA is secreted by luminal epithelial cells of prostatic glands. Serum PSA level above 4 ng/ml is noted in most cases of adenocarcinoma of prostate and if it is increased more than 0.15 per unit volume of prostate (PSA density), it is indicative of adenocarcinoma of prostate. [4]Androgen receptor (AR) also known as NR3C4 is a type of nuclear receptor which is activated by binding of either of the androgenic hormones. The ARs are closely related to progesterone receptor (PR) and progestins in higher dose can block the ARs.
AR remains important in the development and progression of prostatic carcinoma and AR expression is maintained throughout prostate carcinoma progression and the majority of androgen-independent or hormone-refractory prostate carcinoma express AR. [5] Estrogen receptor (ER) and estrogen are implicated in prostatic carcinogenesis and tumor progression. [6] The PRs are also nuclear receptors and progressive emergence of PRs during tumor progression obviously reflects the ability of metastatic and androgen-insensitive tumors to use estrogens through an ER-α-mediated pathway. So, antiestrogens and SERMs can suppress progression of prostatic carcinoma. [7]Here, our objective of this study was to correlate the histopathology of prostatic tissues resected due to different growth with PSA level in serum and expression of AR, ER and PR by immunohistochemistry (IHC).

Materials and Methods

The study was done in the Departments of Pathology and Urology of IPGMER, Kolkata, during the period of July 2008 to August 2010. A total of 50 cases were collected which were diagnosed in Urology Dpt. as cases of prostatic growth. Among them, 35 were Transurethral resection of prostate (TURP) specimens with clinicoradiological diagnosis of NHP, 05 were trasurethral ultrasonography-guided biopsy (TRUS-BX) specimens and remaining 10 specimens were of radical prostatectomy specimens with clinicoradiologic and biochemical markers favoring prostatic adenocarcinoma.
Gross details of sent specimens along with clinical, radiological and serum PSA level of all patients were noted. Hematoxylin and Eosin (HandE)-stained sections were prepared for routine histopathological evaluation to see nature of growth including Gleason scoring in cases of carcinoma. Poly-l-Lysine-coated slides were used for immunohistochemical staining for AR, ER and PR. The different reagents for IHC were provided by Biogenex including positive control. AR, ER, and PR expressions were assessed by ′Quick-Score′ as applied in breast tissue.
Statistical analysis was done by using STATISTICA data analysis software version 6.0 (Tulsa, Oklahoma; Statsoft, Inc., 2001) considering a ′P′ value below 0.05 as significant.

Results and Analysis

We studied total fifty (50) cases including TURP, TRUS-BX and specimens of radical prostatectomy of which 34 cases were diagnosed as NHP (68%), 4 cases as PIN (8%) and12 cases as prostatic adenocarcinoma (24%) as per routine histopathology [Figure - 1].{Figure 1}The mean age was 68.66 years. Among all only 7 patients were under 60 years, 22 were between 61 and 70 years, 17 were between 71 and 80 years and 4 patients were above 80 years of age. Among the 34 cases of NHP, 6 cases were under 60 years, whereas 3 cases were above 80 years. All cases of PIN were noted above 70 years of age. Among the carcinoma cases 7 cases were seen in between 71 and 80 years of age, 3 cases were between61 and 70 years, and one case each below 60 years and above 80 years.PSA values >10 ng/ml were noted in 11 cases of carcinoma and among which 7 cases had >100 ng/ml. Twenty-nine cases of NHP subjects had PSA values <4 ng/ml and rest 5 cases had PSA values within range between 4 and 10 ng/ml. In two cases of PIN, PSA were between 4 and10 ng/ml and other two cases had PSA values within range between 11 and 99 ng/ml [Table - 1]. Higher PSA values ranging between 55.6and 1011.3 were observed in nine cases of prostatic adenocarcinoma with a high Gleason score between 8 and 10, whereas it was in the range of 12.13-57 in cases with score 7 (2 cases) and one case with score 6 had PSA value 8.2 [Table - 2].
ER expressions analyzed by immunostaining were negative in all cases. PR expression was strongly positive in 10 cases of NHP, 1 case of PIN and 4 cases of Prostatic adenocarcinoma. The remaining cases were negative [Figure - 2].{Figure 2}AR expression was strongly positive in 4 cases of NHP, 2 cases of PIN and all 12 cases of adenocarcinoma. It was weakly positive in 30 cases of NHP and 2 cases of PIN. None was negative [Table - 3] and[Figure - 3].{Figure 3}

Discussion

In this study, it was found that all the patients of prostatic growth were in the older age group.
The mean age was 68.66 years. No significant age difference was detected between benign and malignant cases. Men et al. found similar age distribution. They found the mean age to be 64.67 years for prostatic growth lesions. [8]NHP is the most common finding in routine histopathological examination followed by prostatic adenocarcinoma and PIN, respectively, the results corroborating the results of Men et al.
A majority of NHP cases had normal serum PSA values. Only three cases had the values falling in the grey zone. Two cases had significantly raised PSA values, whereas 50% of PIN cases had PSA values falling in the grey zone. Among the 11 cases of carcinoma with raised PSA, 7 cases had it >100 ng/ml. Mean PSA was significantly higher in carcinoma than that of NHP and PIN. Serum PSA values were much higher in carcinoma than that of NHP with P value 0.00001, which is also corroborated by the results of study by Aboseif et al[9]
In our study, 75% of the adenocarcinoma cases showed higher Gleason scoring between 8 and 10. This finding is identical to the study results of Humprey. [10]
So, in our study, higher serum PSA was seen in cases with higher Gleason score showing a positive correlation.ER expression in prostate tissues was negative in all cases of NHP, PIN and prostate carcinoma. These IHC results were identical to that of other studies such as Wernert [11] and Kang et al[12] Wernert et al. found the ER and PR were demonstrated by IHC in nuclei of periglandular fibrocytes and smooth muscle cells and hyperplatic basal cells, but glandular secretory epithelium were negative and thus in prostatic carcinoma cases in their study ER and PR were negative. They concluded that estrogens might contribute to NHP by triggering stromal proliferation with a secondary inductive epithelial growth. Obviously, they do not act directly on prostatic carcinoma but inhibit growth via the hypophyseal-testicular axis. The biologic significance of the PR in prostatic carcinoma is unknown. The PR expressions of carcinoma cells and stromal cells in prostatic carcinoma were found in 93.3% and 76.7%, respectively. The PR were immunoreactive in stromal cells around carcinoma cells, as demonstrated in studies done by Kang et al., [12] Hiramatsu [13] and Bonkhoff et al[14]In our study, 82.35% of NHP cases showed PR expression (including weak expression also), whereas 41.67% of carcinoma cases showed PR expression. In Fisher′s exact test (two-tailed), a P value was 0.021 between NHP and carcinoma cases, which is statistically significant.
All the prostatic growth lesions in our study were positive for AR expression with varying staining intensity. Only 11.78% of NHP cases, 50% of PIN cases and 100% of carcinoma cases showed strongly positive AR expression. So, prostatic carcinoma cases showed highest content of AR among other prostatic lesions. It is statistically significant (P value < 0.0001) between carcinoma and NHP. Our study showed identical result of AR expression in prostatic lesions to the studies done by Qui Yi-Q et al[15] and Brolin et al[16] Qui-Yi-Q et al. had done a study to evaluate AR expression in clinically localized prostatic carcinoma. AR immunoreactivity is almost exclusively nuclear and was observed in tumor cells, non-neoplastic glandular epithelial cells and a proportion of peritumoral stromal cells. Mean percentages of AR-positive cells were significantly higher in cancer tissues compared to that in normal prostatic tissues (P < 0.001). A comparison with Gleason score yielded similar correlation. Brolin et al.analyzed AR, PR and ER contents in cytosol and salt-extractable nuclear subcompartments from 6 normal, 39 NHP and 7 malignant prostatic tissue specimens using the radioligand-binding assay technique. The highest content was found in the cytosol and nucleic acid from malignant prostatic tissues.

Conclusion

From this study, we observed that among our patients with a mean age of 68.66 years whose specimens of prostate were sent from urology department to our pathology department for the histopathological study, NHP cases were most common and PIN were least common. Serum PSA was within normal limits in NHP cases, but higher in prostatic carcinoma cases and also more in higher Gleason score and grey-zone in PIN cases. Sex-steroid receptor status as seen by IHC was divergent in different types of prostatic growth lesions. PR was positive in most cases of NHP and almost half of carcinoma cases. All lesions showed positive staining of AR with highest expression in carcinoma cases. But, all cases were ER negative. With these findings, antiandrogen and antiprogesterone therapy may be indicated in the treatment of prostatic adenocarcinoma.

References
1.Jonathan I. Epstein- the lower urinary tract and male genital system, In: Kumar V, Abbas AK, Fausto N, Editors, Robbins and Cotran Pathologic basis of disease, 7 th ed, Chapter 21, Saunders: Elsevier; reprint 2006. p.1047,48,50,55.  Back to cited text no. 1    
2.Yeole BB, Jussawalla DJ. Descriptive epidemiology of the cancers of male genital organs in greater Bombay. Indian J Cancer 1997;34:30-9.   Back to cited text no. 2  [PUBMED]  
3.Rosai J, Ackerman. Male reproductive system, prostate and seminal vesicles. In: Rosai J, Ackerman, Editors. Rosai and Ackerman's surgical pathology, 9 th ed, Vol. 1, Chapter 18, New Delhi: Mosby, Elsevier; reprint 2005. p. 1361-62,1369.  Back to cited text no. 3    
4.Chakrabarti S, Raha K, Bhunia CL, Bhattachary DK. Department of Pathology, North Bengal Medical College and Hospital, Siliguri, The usefulness of prostate specific antigen density as a screening method for prostatic carcinoma. J Indian Med Assoc 2001;99:627-8, 630.  Back to cited text no. 4    
5.Androgen receptor, Wikipedia, the free encyclopedia, 22 September, 2010.  Back to cited text no. 5    
6.Bonkhoff H, Fixemer T, Hunsicker I, Remberger K. Estrogen receptor expression in prostate cancer and premalignant prostatic lesions. Am J Pathol 1999;155:641-7.   Back to cited text no. 6    
7.Progesteron receptor, Wikipedia, the free encyclopedia, 18 September, 2010.  Back to cited text no. 7    
8.Men S, Cakar B, Conkbayir I, Hekimoglu B. Detection of prostatic carcinoma: The role of TRUS, TRUS guided biopsy, digital rectal examination, PSA and PSA density. J Exp Clin Cancer Res 2001;20:473-80.  Back to cited text no. 8    
9.Aboseif S, Shinohara K, Weidner N, Narayan P, Carroll PR. The significance of prostatic intra-epithelial neoplasia. Br J Urol 1995;76:355-9.   Back to cited text no. 9    
10.Humphrey PA. Gleason grading and prognostic factors in carcinoma of the prostate. Mod Pathol 2004;17:292-306.  Back to cited text no. 10  [PUBMED]  
11.Wernert N, Gerdes J, Loy V, Seitz G, Scherr O, Dhom G. Investigations of the estrogen (ER-ICA-test) and the progesterone receptor in the prostate and prostatic carcinoma on immunohistochemical basis. Virchows Arch A Pathol Anat Histopathol 1988:412:387-91.  Back to cited text no. 11    
12.Kang MS, Park SY, Yoon HK. Estrogen and Progesterone Receptor Expressions in Benign Prostatic Hypertrophy and Prostatic Adenocarcinoma. Korean J Pathol 1998;32:346-51.  Back to cited text no. 12    
13.Hiramatsu M, Maehara I, Orikasa S, Sasano H. Immunolocalization of oestrogen and progesterone receptors in prostatic hyperplasia and carcinoma. Histopathology 1996;28:163-8.  Back to cited text no. 13    
14.Bonkhoff H, Fixemer T, Hunsicker I, Remberger K. Progesterone receptor expression in human prostate cancer: Correlation with tumor progression. Prostate 2001;48:285-91.  Back to cited text no. 14    
15.Qiu YQ, Leuschner I, Braun PM. Androgen receptor expression in clinically localized prostate cancer: Immunohistochemistry study and literature review. Asian J Androl 2008;10:855-63.  Back to cited text no. 15    
16.Brolin J, Andersson L, Ekman P. Steroid receptor profile and receptor stability in subfractions of human prostatic tissues, Urol Res 1991;19:327-31.  Back to cited text no. 16    

Copyright 2014 - Indian Journal of Medical and Paediatric Oncology

The following images related to this document are available:

Photo images

[IndianJMedPaediatrOncol_2014_35_1_40_133719_f4.jpg]  [IndianJMedPaediatrOncol_2014_35_1_40_133719_f5.jpg]  [IndianJMedPaediatrOncol_2014_35_1_40_133719_f6.jpg]  [IndianJMedPaediatrOnc

Thursday, 5 February 2015

Payton Yerke Professor Christensen English 2010 21 October 2014 about Near Death Experience

BY


 The Science of Ghosts and the Essence of the Human Soul Ghosts and the sense of an afterlife have enthralled our imagination, media, and religions for centuries. In a recent poll, it was found that 45% of all Americans believe ghosts to be real (Gayomali). In a separate poll, 22% reported sensing a ghostly presence or experiencing an apparition (McDonald). As a young teenager, I remember going out on late night ghost-hunting trips with the latest teenage-ghost-hunting equipment: a camera phone to record what we saw. Most of the time we never saw anything at the reportedly haunted locations we visited, but there were also the rare occasions where unexplained shadows, movements or, even, figures occurred. With so much reported phenomena, can the existence of poltergeists be supported or proven scientifically or is it merely an illusion born of religious faith? Religion contributes significantly to the belief in the human soul and ghosts. For those of Christian-based faiths, a common belief is that eternal life will be awarded to the faithful. With such views, death is seen, not as a termination, but as a transformation from their corporal selves to an eternal being that will then go to Heaven and return to God or their Creator. This conviction of the essence of a human soul is essential to support the tantalizing idea of everlasting life after death (Handley). Religious beliefs in the afterlife have prompted the scientific investigation to determine whether we, as humans, possess a soul and if the soul continues to live after our mortal death. A study was conducted by Robert Schoch, the Associate Professor of Natural Science at Boston  University, on the near-death experiences and the correlation between geomagnetic waves on brain waves. The study resulted in the theory of crisis apparitions, which occur when an individual sees the ghost of a faraway relative moments before the individual dies. In regards to the study, Schoch explained, “Some people will dismiss this as coincidence, but there have been, in my assessment, very good statistical studies of such things that take it out of the realm of coincidence” (McDonald). Further studies regarding the existence of a human soul have been conducted. One such experiment done by Dr. Duncan MacDougall in 1907 studied the weight fluctuations during the death process. Six terminally ill patients were observed before, during, and after the death process. They were placed on a bed that would record the patients’ weight, sensitive to two tenths of an ounce. In detailed, written accounts of his study, MacDougall explained that, with every patient, the rate of weight-loss, due to perspiration, evaporation of moisture and moisture of respiration, during the death-process was calculated. At the exact moment of death for each patient, there was a sudden loss of weight of approximately 21 ounces. Further investigation of this sudden weight loss found that the bowels did not move, no urination occurred and the loss of air in the lungs did not affect the patients’ weight. MacDougall concluded that the loss of weight was not a product of physiological attributes, rather from spiritual. He theorized that the loss of weight is a result of the human soul leaving the body (MacDougall). Another experiment investigating the correlation of the human soul and near death experiences (NDEs) was conducted by Kumar Pranab Bhattacharya in 2013. According to Bhattacharya, an NDE refers to a broad range of experiences of people associated with impending death. However, somehow these people managed to be revived back to life. Cases of NDEs are often reported after people have been pronounced clinically dead or close to death. These reported experiences include a review of one's life, an out-of-body experience or astral projection, visions of themselves passing through a dark tunnel, seeing a bright light, seeing and talking to God, seeing foreign lands, seeing dead relatives, or seeing the future. To further support these reports, most people who underwent a NDE, even people who are non-religious, reported substantially decreased fear of death and an increased acceptance of an afterlife and reincarnation (by Bhattacharya). Many skeptics challenged the results found by Bhattacharya pranab kumar. The major controversy occurred when other chemical factors were found that produced experiences similar to that of NDE. Chemicals such as Ketamine, Phencyclidine, LSD, pilocarpine, andmescaline( Bhattacharya Pranab kumar) induce experiences that consist of unconsciousness, out-of-body experiences, and occurrence of a bright light. Nonetheless, these experiences are not identical to NDE in that they are characterized by fragmented and random memories rather than a recollection of one’s entire life. They also lack the decreased fear of death that individuals who experienced an NDE obtained (Bhattacharya pranab kumar ). The presence of near death experiences and the faith in a human soul evokes the mystery of life after death. Like Christians, Hindus, Buddhists, and Jews believe in spirits. However, Hindus, Buddhists, and Jews believe that the spirits of the dead can attach themselves to places, people, possessions or pleasures that cause the individual to be in spiritual limbo. These spirits are seen as suffering people that need help moving on to the afterlife. Buddhism teaches methods on how to free ghosts from earthly bondage by directing them toward the golden light. These religions also believe that spirits of deceased individuals can attach and possess the bodies of the living in order to influence the host. As a result, Judaism teaches rituals of ghost exorcism that both heals the ghost and the host. Although the West is highly influenced by the Christian belief,  the idea of ghosts walking among us, haunting a location, or possessing the living endures throughout the generations and has both frightened and fascinated us (Handley). Ghost stories have endured throughout the centuries. The first reported poltergeist experience dates back to Pliny the Younger in the first century A.D. in Athens, Greece. He described his poltergeist experience in a letter to Licinius Sura: There was at Athens a large and roomy house, which had a bad name, so that no one could live there. In the dead of the night a noise, resembling the clashing of iron, was frequently heard, which, if you listened more attentively, sounded like the rattling of chains, distant at first, but approaching nearer by degrees: immediately afterwards a spectre appeared in the form of an old man, of extremely emaciated and squalid appearance, with a long beard and disheveled, hair, rattling the chains on his feet and hands (Younger). The existence of earthbound spirits, or ghosts, has been questioned and studied upon multiple accounts. In an interview with ghost expert, Michael Lopez Sr., he explained that the human body is composed of energy. As humans, we all give off different types of energy, or auras. The energy within us can be measured on a spectrum of high to low. Bad spirits and demons give off low energy levels, while good spirits give off high energy that the living can physically feel. Some people, including himself, are more sensitive to energy and can sense or even see and converse with spirits. He gave detailed experiences where, as a child, he would ask spirits for a ride on his sister’s bed. In response, the bed would begin to shake and move around the room. He theorized that the spirits were able to accomplish this action because they were composed of energy and had the ability to manipulate the energy around them (Lopez).  Most theories involving ghosts as beings of energy claim that the transition between the mortal and spiritual worlds are in relevance to Einstein’s Law of Conservation of Energy. The Law of Conservation of Energy states that the total amount of energy in an isolated system remains constant over time. For an isolated system, this law means that energy can change its location within the system and change its form within the system, but that energy can be neither created nor destroyed. The human body generates enough electricity to sustain a small flashlight. If energy cannot be destroyed, rather it can be transformed, then what happens to the electricity in the human body after death? Ghost researcher and notable author, John Kachuba, wrote: Einstein proved that all the energy of the universe is constant and that it can neither be created nor destroyed. ... So what happens to that energy when we die? If it cannot be destroyed, it must then, according to Dr. Einstein, be transformed into another form of energy. What is that new energy? ... Could we call that new creation a ghost (Kachuba)? Skeptics dismiss John Kachuba’s theory of the Law of Conservation of Energy as a false explanation of ghosts, claiming that after death the energy of the body passes through an ecosystem via photosynthesis and the consumption of organisms. When the human body is deceased, it begins to decompose and the energy stored within the body is lost to heat or is consumed by microorganisms and other organisms. Though Kachuba uses the language of science to support his theories, he lacks the understanding of energy processes, scientific experimentation, and data to support his ideas. In a sense, Kachuba is attempting to use science to explain phenomenon that exist beyond the realm of normal science. While Kachuba tried to use science to justify his spiritual beliefs, real scientists have used new technology to discredit many reports of haunting and poltergeist experiences. In a careful  case study, William Holland Wilmer examined the past documentation of a haunting witnessed by the “H” family after they moved into an old, large and gloomy house that was presumable haunted in 1912. Mrs. H kept a journal of the odd happenings within the house. She described pots and pans that crashed seemingly on their own, strange voices calling out the names of Mrs. H and her children, and footsteps that could be heard throughout the hallways. She also described feeling presences and seeing dark figures. She wrote, “On one occasion, in the middle of the morning, as I passed from the drawing room into the dining room, I was surprised to see at the further end of the dining room, coming towards me, a strange woman, dark haired and dressed in black.” In another account, she wrote, "It had always been Mr. H’s habit at night before going to bed to sit in the dining room and eat some fruit. In this house when seated at night at the table with his back to the hall, he invariably felt as if someone was behind him, watching him. He therefore turned his chair, to be able to watch what was going on in the hall.” Over time, the inhabitants of the household grew extremely tired, depressed, and sluggish. They all developed colds and headaches that couldn’t be relieved. After a while, all the plants within the house withered and died (Wilmer). After investigating the house, Wilmer found an odd culprit behind the presumed haunting; it was carbon monoxide poisoning. He found that the furnace was leaking the odorless gas through the chimney, thus causing oxygen deprivation. The deprivation of oxygen was causing the illnesses and hallucinations witnessed by the “H” family (Wilmer). Other surprising factors have also led to the perception of paranormal activity. Stimulation of the Angular gyrus within the brain creates similar experiences that are often reported as paranormal. Excessively stimulating the Angular gyrus results in the perception and hallucination of shadowy figures. In a study done by Michael Persinger Spain, he utilized a  helmet that emitted electrodes into the brain to directly stimulate the Angular gyrus in order to induce the presence of angels and demons. Eighty percent of all the participants reported seeing a shadowy figure standing beside them in the experimentation room. Furthermore, the location and presence of the figure could be directly controlled by the currents of the electrodes emitted from the helmet and the location at which they stimulated the Angular gyrus (Green). How the brain reacts to energy waves and electrical impulses plays a key role in reported hauntings. In a published encounter, Vic Tandy, from the School of International Studies and at Law Coventry University, was working in his classroom medical lab in 1998. Ghostly encounters began to be reported from both the staff and students. A custodial lady even resigned after witnessing a paranormal apparition. Many of the students, and Tandy himself, reported seeing a dark figure out of the corner of their eye watching them. However, whenever someone turned to face the figure, it had vanished. One day, Tandy brought a fencing sword into the laboratory. As he entered, he noticed that the free end of the blade was frantically vibrating up and down. The vibrations were varying in intensity at a rate equal to the resonant frequency of the blade, which is a characteristic identical to that of energy emitted by sound waves at a low frequency, otherwise known as infra sound waves (Tandy and Lawrence). Infra sound waves usually can’t be perceived by human ears because they vibrate 1 to 20 vibrations per second, which is too low for the human range of hearing. However, humans can sense the presence of infra sound waves. Encountering infra sound waves can cause nausea, anxiety, and chills. It can also trigger the brain to slightly vibrate the eyeballs, which can make the victim experience hallucinations, such as shadowy figures (Tandy and Lawrence). Further investigation into the source of the infra sound waves established that the vibrations got bigger as the blade was moved towards the middle of the room and the amplitude  of the vibrations greatly reduced or stopped altogether as the sword got closer to the walls of the room. The culprit behind the infra sound waves was a newly-installed fan, with a frequency of 18.98 hertz. The sound waves originating from the fan resonated around the room and bounced off the walls which caused it to collide with itself, creating a strong standing wave in the middle of the laboratory (Tandy and Lawrence). Other researchers used Tandy’s scientific findings to discredit other reported hauntings. However, these researchers have not succeeded in tracing all reported encounters with the supernatural back to psychological mis perceptions. Tandy’s discovery of environmental factors contributing to poltergeist events prompted Richard Wiseman to investigate, through multiple experiments, other environmental factors resulting in the perception of a presence or paranormal encounter. One such experiment conducted by Wiseman involved South Bridge in Edinburgh, Scotland. South Bridge was constructed in the late eighteen century. For a public service, a series of rooms and corridors were built under the bridge to house the poor and homeless. Due to overpopulation, these vaults became disease-ridden and abandoned in the late nineteenth century. In 1997, the vaults were reopened and became an attraction for public tours. Not long after the reopening of the faults, tourist began to report feeling presences, unusual footsteps, and the appearance of spirits in some of the rooms. Wiseman designed an experiment to see if people who were not familiar with the reputations of each of the rooms would sense anything unusual with them (R. Wiseman, C. Watt and P. Stevens). In a four day trial, volunteers toured the vaults and recorded any unusual experiences of phenomenon they experienced. Architecture, lighting levels, air movement, temperature, and magnetic field levels were also prerecorded. When the final data was examined, the volunteers were consistent with rating certain rooms as more haunted than others. This data also correlated  with past records of haunting reports kept by the tour company. However, when the environmental factors of all the rooms deemed as haunted were taken into account, the volunteers were more likely to have reported unusual experiences in rooms with high ceilings, high levels of exterior lighting directly outside the vault, and high magnetic field levels. Wiseman concluded that people report more haunted experiences because they feel more vulnerable in a room with a high ceiling and when they walk from a well-lighted area to a darker room. Furthermore, the strong magnetic waves found in all the reportedly haunted rooms stimulates the Angular gyrus, creating a feeling of anxiety and fear (R. Wiseman, C. Watt and P. Stevens). In another experiment conducted by Richard Wiseman, he investigated the correlation between reported hauntings and the belief in ghosts. His experiment took place in Hampton Court Palace, one of the most reportedly haunted places in England. His experiment was meant to discover the extent that belief in ghosts, suggestion, and magnetic fields accounted for the alleged hauntings. Over 600 participants took part of the experiment, and each participant was given a questionnaire that measured their belief in ghosts, past unusual experiences and whether they believed ghosts were the underlying reason behind the unusual experience. After reporting all the occurrences of unusual happenings while in Hampton Court, Wiseman concluded that participants who had previous beliefs of the paranormal reported experiencing more frequent anomalous activities and were more likely to attribute them to a spiritual presence (R. Wiseman, C. Watt and E. Greening). In the second portion of the experiment, half of the participants were told prior to entering Hampton Court that it was historically associated with hauntings and other paranormal activity. The second half of the study group wasn’t told anything about the area’s history before  entering. The relationship between suggestion and the reported results of paranormal activity was significant. Also, results supported the association between reported poltergeist and magnetic waves (R. Wiseman, C. Watt and E. Greening). Psychological advancement and understanding has explained many physiological effects that correspond with a spiritual encounter. Oftentimes, the encounter with a threatening spirit is reportedly characterized by a sense of awaking from a sleep with bodily paralysis. Imagine trying to move or scream but, regardless the struggle, the body won’t respond. In addition, many reported experiences described feeling crushed by an invisible presence. During these experiences, many reports of unnerving blurry figures, whispers, and footsteps occurred. This phenomenon is commonly referred to as “ghost press” in the Chinese culture. However, further investigation behind the psychological aspects of ghost press presented a new understanding of this spooky occurrence. Rather than a poltergeist experience, ghost press is simply sleep paralysis. Dr. Priyanka Yadav of the Somerset Medical Sleep for Life Center in New Jersey explains that the phenomenon occurs when there's a disconnect between the mind and body as people enter or exit REM sleep. In a sense, it is equivalent to dreaming while awake. "It seems like you're paralyzed, which naturally occurs when you're sleeping, but this somehow happens while you're awake. It can last from a few seconds to a minute or two and is often associated with hypnagogic hallucinations, things you might see when trying to fall asleep or hypnopompic hallucinations, things you see when you're trying to wake up." To further support this theory, 79% of ghost press occurrences were reported between 2 a.m. and 5 a.m., the most common time-frame that the human brain causes hallucinations (Gayomali). In conclusion, both believers and skeptics approach the human soul and the existence of an afterlife, whether on Earth as a ghost or in some other realm, as a metaphysical idea that is  difficult to verify with concrete scientific evidence. Believers regard the soul as the essence of our consciousness; skeptics regard it as an illusion. Scientists have yet to prove or disprove its existence. Scientists have explained some supposed spiritual encounters as illusions caused by biochemical disruptions. Still, they have not yet fully explained other reports, particularly those of near death experiences. Skeptics still discredit those reports saying they are from individuals drawing on hope and religion, not science. But when will science disprove hope or religion? When exploring the realm of the metaphysical, we find the door to faith is always open.     
 by 
                                                 
                                                Works Cited

2] Gayomali, Chris. "4 possible scientific explanations for ghosts." The Week 25 October 2013. Web. Green, Laci. Do Ghosts Exist? Exploring the Paranormal 2013. Web.

3] Handley, Sasha. Visions of an Unseen World: Ghost Beliefs and Ghost Stories in Eighteenth‐Century England. London: Brookfield, 2007. Print. 

4] Kachuba, John. Ghosthunters: On the Trail of Mediums, Dowsers, Spirit Seekers, and Other Investigators of America's Paranormal World. New Page Books, 2007. Print.

5 Lopez, Michael I. Interview. Payton Yerke. 18 October 2014. 

6] MacDougall, Duncan. "Hypothesis Concerning Soul Substance." American Medicine 2 (1907): 395‐397. Web. McDonald, Glenn. "Ghost Stories: The Science Behind Sightings." 29 October 2013. Web.

7]  Tandy, Vic and Tony R. Lawrence. "The Ghost in the Machine." Journal of the Society for Psychical Research 62.851 (1998). Web. 1 November 2014. Wilmer, William Holland. American Journal of Ophthalmology 17.6 (1934): 522–523. Web. 29 October 2014. 

8] Wiseman, R, et al. "An investigation into the alleged haunting of Hampton Court Palace : Psychological variables and magnetic fields." Journal of Parapsychology 66.4 (2002): 387‐408. Web.Yerke 13 

9] Wiseman, Richard, et al. "An investigation into aleged ‘hauntings’." British Journal of Psychology 94 (2003): 195–211. 30 October 2014. 

10] Younger, Pliny the. Pliny the Younger (A.D. 62?–c.A.D. 113). Letters. 27 March 2013. Web. 21 October 2014.



                                                           Bibliography 
Houran, James and Rense Lange. "Searching for an Optimal Level of Transliminality in Relation to Putative PSI." Journal of the Society for Psychical Research (2009): 92-102. Academic Search Premier. 
Radford, Benjamin. Do Einstein's Laws Prove Ghosts Exist? 9 November 2011. Web. 19 September 2014. 
The Museum of Unnatural Mystery. The Science of Ghosts and Hauntings. 2009. Web. 28 September 2014. 
What are Ghosts Really? 5 Paranormal Theories. 28 July 2014. Web. 28 September 2014. Wilson, Tracy V. How Ghosts Work. 27 October 2006. Web. 28 September 2014.

Sunday, 11 January 2015

Invitation to Professor(Dr) Pranab Kumar Bhattacharya to attain as "Delegate" at 2015 Nobel peace Prize Forum To join International Peace Building Community

Subject:Invitation to the 2015 Nobel Peace Prize Forum
From:Nobel Peace Prize Forum (info@nobelpeaceprizeforum.org)
To:profpkb@yahoo.co.in;
Date:Thursday, 8 January 2015 10:22 PM


Email not displaying correctly? View it in your browser.
AN INVITATION TO JOIN THE INTERNATIONAL PEACEBUILDING COMMUNITY AT THE 2015 NOBEL PEACE PRIZE FORUM

March 6-8 2015
Radisson Blu Downtown Minneapolis 
[MAP]


Dear Professor(Dr.)Bhattacharya

We are pleased to invite you to attend, as a delegate, in the 2015 Nobel Peace Prize Forum – which will concentrate on issues related to sustainable and inclusive peacemaking and peace building.
It will feature the works of 2013 Nobel Laureate, the Organization for the Prohibition of Chemical Weapons (OPCW) and Former United States President and Nobel Laureate Jimmy Carter and his latest book: “A Call to Act: Women, Religion, Violence and Power”.
The Forum will also address critical issues of our time, featuring talks by courageous peacemakers, world leaders, and influential thinkers including Monica McWilliams,Steven Pinker, Imam Muhammad Ashafa and Pastor James Wuye.

Each day,Honarable delegates will have the opportunity to participate in dialogue sessions led by international mediation and peace building experts involved with the United Nations and others in situations such as Syria, Libya, Yemen, and the Central African Republic. There will also be sessions dedicated to issues such as Ebola, gun violence in the United States, disarmament, chemical weapons control, sustainable food , food security, climate change, social entrepreneurship, women, peace and security and more.

On Saturday evening March 7th, the Forum will be screening the award winning documentary 
Food Chains, followed by a conversation with the film’s producers by delegates.

A delegate’s dinner and conversation focused on sustainable food will also be offered as an option in advance of the documentary screening. The screening is included with Saturday's delegate ticket. 

Tickets to the Nobel Peace Prize Forum are limited and will be reserved on a first come, first serve basis. We look forward to you joining us at this important international peacebuilding opportunity! 

NOBEL PEACE PRIZE FORUM

Under the auspices of the Norwegian Nobel Institute, the Nobel Peace Prize Forum inspires peacemaking by focusing on the work of Nobel Peace Prize winners and important international peacemakers and peacebuilders.

You received this email because you previously participated in, or as a member  of Nobel Peace Prize Forum or are a friend of, the Nobel Peace Prize Forum
This email was sent to  profpkb@yahoo.co.in  from Nobel Peace Prize Forum · 2211 Riverside Avenue South · Minneapolis, MN 55454 · USA 

Tuesday, 30 December 2014

Synthetic DNA and artificial cell  what are the ethical issues its application in the real life and in human disease at cost of 400 million dollars Research"

Authors are
o*Professor Pranab Kumar Bhattacharya MD(cal univ) FIC path(Ind),Professor Dept of pathology
*Rupak Bhattacharya Bsc(cal.univ )MSc(JU), **Ritwik Bhattacharya B.com(cal.Univl), **Somayak Bhattacharya BSC (HM)(IGNOU)  MSc( PUSHA) - Asst Lecturer of IHM Ahemadabad India - Residences 7/51 Purbapalli,Sodepur, Kol­110, ***Miss Upasana Bhattacharya - “  Only Daughter of Prof PK Bhattacharya  **Dalia Mukherjee BA(hons) cal Univ, Miss Oindrila Mukherjee, Miss Ayshi Mukherjee    Dr Hriday Das MD(cal.Univ ) DTM&H(cal Univ) Dr Tarun Biswas MBBS(cal Univ) Dept of Pathology
*Previously  at Institute of Post Graduate Medical Education Research 244 AJC Bose Road kol-20 West Bengal, India, Now Posted as Professor&HOD of Pathology  at Murshidabad District Medical College Behrampore Murshidabad West Bengal
Published online 24 May 2010 | Nature | doi:10.1038/news.2010.261

A synthetic creation story Claims of 'synthetic life' reflect only our changing conception of what life is and how it might be made, says Philip Ball. Philip Ball Last week's announcement of the 'chemical synthesis of a living organism' by Craig Venter and his colleagues at the J. Craig Venter Institute1heads up a very long tradition. Claims such as this have been made throughout history.That's not to cast aspersions on the new results. One can challenge the idea that Venter's bacterium stands apart from Darwinian evolution, modelled as it is on Mycoplasma mycoides.It is nonetheless an unprecedented triumph of biotechnological ingenuity.
But, set in a historical context, what the researchers have achieved is not so much a 'synthesis
of life' as a semi-synthetic recreation of what we currently deem life to be. And, as with
previous efforts, it should leave us questioning the adequacy of that view.
To see that the new results reiterate a perennial theme, consider the headline of the Boston
Herald in 1899: "Creation of Life. Lower Animals Produced by Chemical Means." The article
described how German biologist Jacques Loeb induced an unfertilized sea-urchin egg to divide
and develop into a larva by treating it with salts. Loeb went on to talk in earnest about "the artificial production of living matter", and he was not alone in blending his discovery with speculations about the de novo creation of life. In 1912, the physiologist Edward Albert Schäfer alluded optimistically to Loeb's results in his presidential address to the British Association, in which he expressed great optimism about "the possibility of the synthesis of living matter"2 .Such claims are commonly seen to imply that artificial human life is next on the agenda. It wasa sign of the times that the New York Times credulously reported in 1910 that, "Prof.Herrera, a Mexican scientist, has succeeded in forming a human embryo by chemical combination". It is surely no coincidence that many media reports have compared Venter to Frankenstein, or that the British newspaper The Observer mistakenly suggested he has"succeeded in 'creating' human life for the first time".
What is life?
Beliefs about the feasibility of making artificial organisms have always been governed by the
prevailing view of what life is. When the Universe was seen as an intrinsically fecund matrix,
25-5-2010 A synthetic creation story : Nature Ne…nature.com/…/news.2010.261.html 1/7“'Life' in biology,rather like 'force'in physics, is aterm carried over from a time when scientists thought quite differently,when it served as a makes hift bridge over the inexplicable.”permitting bees and vermin to emerge from rotten flesh by spontaneous generation, it seemed natural to imagine that sentient beings might issue forth from insensate matter. Mechanical models of biology developed during the seventeenth century fostered the idea that a 'spark of life' — after the discovery of electricity, literally that — might animate a suitably arranged assembly of organic parts. The blossoming of chemistry and evolutionary theory in the nineteenth century, meanwhile, spurred a conviction that it was all about getting the recipe right, so that nature's diverse grandeur sprung from primordial colloidal jelly called protoplasm. Yet each apparent leap forwards in this endeavor more or less coincided with a realization that the problem is not so simple. Protoplasm appeared as organic chemists were beginning to erode the concept of vital ism and to appreciate the baffling constitution of organic matter. The claims of Loeb and Schäfer came just before tools for visualizing the sub cellular world began to show the incredible complexity of life's micro structure. And it was the same story for the next big splash in 'making life', when in 1953 Harold Urey and Stanley Miller announced their celebrated 'prebiotic soup' experiment, in which they conjured amino acids from simple raw materials. Some press reports regarded this as a new genesis, in principle if not in practice. Yet that same year saw the game-changing discovery oflife's informational basis in the work of Crick and Watson. Now life was not so much about molecules, but about cracking, and perhaps then rewriting, the genetic code.No more codes Which brings us to Venter et al. Now that the field of genomics has fostered the belief that in sequencing genomes we are reading a 'book of life', it's easy to see why 'booting up' a wholly synthetic genome in a bacterial host should be popularly deemed a synthesis of life itself. Here the membranes, the cytoplasm — everything except the genes — are mere peripherals to the hard drive of life, whose algorithmic instructions need only be rejigged to produce new organisms. But this latest work should encourage us to lay aside the very concepts of an 'artificial organism'and a 'synthesis of life'. Life is not a thing one makes, nor is it even a process that arises or is set in motion. It is a property we may chooseto bestow, more or less colloquially, on certain organizations of matter.25-5-2010 A synthetic creation story : Nature News…nature.com/…/news.2010.261.html 2/7#10725
Comment  No#10725
Title­"Synthetic DNA and artificial cell – what are the ethical issues its application in the
real life and in human disease at cost of 400 million dollars Research"
Authors
o*Professor Pranab Kumar Bhattacharya MD(cal) FIC path(Ind),Professor Dept of pathology
oRupak Bhattacharya Bsc(cal)MSc(JU), Ritwik Bhattacharya B.com(cal), Somayak Bhattacharya MBA 7/51 Purbapalli,Sodepur, Kol­110, Miss Upasana Bhattacharya – daughter of Prof PK Bhattacharya Dr. Avisnata Das MBBs(cal) Dalia Mukherjee BA(hons) cal Miss Oindrila Mukherjee, Mrs Chandrani Dutta BSC(Zoology)* Dr Hriday Das MD(cal) DTM&H(cal) *Dr Tarun Biswas MBBS(cal) Dept of Pathology
*Institute of Post Graduate Medical Education Research 244a AJC Bose Road kol-20 West Bengal,
India
25-5-2010 A synthetic creation story : Nature Ne… nature.com/…/news.2010.261.html 3/7 India

Artificial life is a field of study and an associated art form which examine systems related to life, its
processes, and its evolution through simulations using computer models, robotics, and biochemistry.
There are three main kinds of artificial life named for their approaches: soft from software; hard , from hardware; and wet, from biochemistry molecules. Artificial life imitates traditional biology by trying to recreate biological phenomena. Artificial life has had a controversial history. John Maynard Smith11 criticized certain artificial life work in 1994 as "fact-free science". However, the recent publication of artificial life articles in widely read world’s top impact factor and coveted science journals such as Science and Nature is evident that artificial life techniques are becoming more accepted in the mainstream­as synthetic biology, at least as a method of studying Darwin’s Chemical evolution. Synthetic and self replicating DNA or RNA is part of such an artificial life and tool for studying evolution of life in earth. Evolving such an artificial DNA in laboratory was thus for long years before attempt of research since Watson and Crick Double Helix. The artificial DNA-like molecule directed the synthesis of copies of itself and then copies of the copies, mimicking the natural process of evolution as it was first outlined by Charles Darwin. A polynucleotide is a building block of DNA, or a "letter" in the genetic alphabet used to write the "book" describing our genetic inheritance. The first Synthetic Virus was done in 2002 in stony brook university Newyork by a team of scientist led by Eckarde wimmr (Science, 9 August 2002, p. 1016) Benner and Michael Sismour- two Graduate student of university of California in 2004 first made a synthetic DNA of 12 nucleotides of a virus but it could not however copied itself. In 2010, The first synthetic and self replicating DNA /cell as a bacterium has been claimed by Professor Dr C J Venter of J. Craig Venter Institute (JCVI) in Rockville, Maryland, and San Diego, California, [ He was best known for his work with the Human Genome Project] is successful and same is published in journal the science[ 1]. The cell is claimed totally derived from a synthetic chromosome [They bought it from a company more than 1000 -1080-base sequences that covered the whole M. mycoides genome], made with four bottles of chemicals on a chemical synthesizer, starting with information and using genetic code created by a super computer. The Venterâ team [20 members team] synthesized the largest piece of DNA so far ” a million units in length ” and in making it accurate enough to substitute for the cell  own DNA at cost of $40 million research. Venter's team said they worked with a synthetic version of the DNA from a small bacterium called Mycoplasma mycoides which was transplanted into another bacterium called Mycoplasma capricolum, which had most of its insides DNA removed. The new microbe came to life and began replicating in the lab dish. Specifically, the team showed that the artificially created DNAlike molecule containing six gene ­building nucleotides – instead of the four found in natural DNA –could support the molecular "photocopying" operation known as polymerase chain reaction. The genome Dr. Venter synthesized is copied from a natural bacterium that infects goats. 580,000 DNA units in length, of a small bacterium, Mycoplasma genitalium. His goal however was to make cells that might take carbon dioxide out of the atmosphere and produce methaneose .Replacing the genome of any bacterial cell with one from another species by transplanting a whole genome as naked DNA is however a long known method as gene cloning[3] / and or gene transfer mechanism called genome transplant. Gene cloning will result a new species[ 2] De novo synthesis of a self replicating bacterial or human DNA is here an increasingly valuable resource for a broad research and future application. Synthesis of Gene /DNA is also not new but an old concept. Synthesis of gene length (1-3Kb) DNA is however very common. The Process of Synthetic DNA construction involves the assembly of Overlapping Oligonucleotides into contiguous fragments of dsDNA using PCR based and or ligation based methods[4 ,5] or by Pair wise Selection assembly(PSA) methods for large scale long length automated synthetic DNA production more then 91Kb DNA6, where A target assembly sequence is broken down into sub-fragments that are synthesized with flanking tags .At PSA level 0, sub-fragments are inserted into one of two PSA vectors where tags activate two, diver gently oriented select-able 25-5-2010 A synthetic creation story : Nature Ne… nature.com/…/news.2010.261.html 4/markers . Level 0 sub-fragment pairs are excised so that only one activation tag is retained for each sub-fragment. Subsequent pair ligation occurs in a second PSA vector where tags activate a second set of select-able markers , producing a PSA level 1 product. This hierarchical process is repeated, switching between two vectors with different selectable markers, until the full-length product is assembled 6.Recently, recombination-based methods were also used range of applications to construct a 134-kb fragment in Bacillus subtilis and 583- Kb fragment of Saccharomyces cerevisiae Synthetic DNA (7,8 ). While synthesis of gene ­length DNA (13 kb) is common, the ability to quickly and cost effectively assemble longer-length DNA (>10 kb) remained of course a challenge. 256 orthologous
genes shared by the Gram-negative Haemophilus influenzae and the Gram-positive bacterial life
Mycoplasma genitalium genomes are a close approximation of a minimal gene set . The Mollicutes,
generically known as the mycoplasmas, are the best experimental platform for experimentally defining a minimal gene set. Mycoplasmas are obligate parasites that live in relatively unchanging nichesrequiring little adaptive capability. M. genitalium, a human urogenital pathogen, is the extreme manifestation of this genomic parsimony, having only 482 protein-coding genes and the smallest genome, at 580 kb, of any known free-living organism capable of being grown in axenic culture[9]
Mycoplasma genitalium has the smallest genome of any organism that can be grown in pure culture. It has a minimal metabolism and little genomic redundancy. Consequently, its genome is expected to be a close approximation to the minimal set of genes needed to sustain bacterial life. To construct synthetic DNA of Mycoplasma genetelium it is always very essential to identify and delete all the putative nonessential gene, isolation and characterization of trasposon mutants and mixture of mutant genes butpreservation and non-disruptions of DNA recombination & six DNA repair gene like recA,recU, DNA hellicase gene like ruvA, ruvB DNA Glycosylase gene mute M which excises oxidized purine from DNA and DNA damage inducible gene[10]In 1995, a team led by the trio Venter, Smith and Hutchison sequenced the 600,000-base chromosome of bacterium Mycoplasma genitalium, the smallest genome of a free-living organism. The microbe has about 500 genes, and researchers found they could delete100 individual genes without ill effect (Science, 14 February 2003, p. 1006) In 2007, Venter, Smith,Hutchison, and colleagues finally demonstrated that they could transplant natural chromosomes fromone microbial species to another (Science, 3 August 2007, p. 632). By 2008, they showed that theycould make an artificial chromosome that matched M. genitalium's but also contained "watermark"DNA sequences that would enable them to tell the synthetic genome from the natural one (Science, 29February 2008, p. 1215) The first Synthetic Virus was done in 2002 in stony brook university Newyork by a team of scientist led by Eckarde wimmr (Science, 9 August 2002, p. 1016)
The synthetic genome created by Venter's team is almost identical to that of a natural bacterium. It
was achieved at great expense; an estimated $40 million, and effort, 20 people working for more than
a decade. Dr. Venter took a first step toward this goal three years ago, showing that the natural DNA
from one bacterium could be inserted into another and that it would take over the host cell’s
operation. He said that before copying the DNA, he excised 14 genes likely to be pathogenic, so the
new bacterium, even if it escaped, would be unlikely to cause goats harm.Dr. Venter calls the result synthetic cell and is presenting the research as a landmark achievement that will open the way to creating useful microbes from scratch to make products like biofuels. At a press conference Thursday, Dr. Venter described the converted cell as “the first self replicating species weâve had on the planet Though the scientists claim for creation of artificial living cell “He has not created life, only mimicked it,â€what we want to say There remains much about the ethical issues to be solved
1] Consequence of progress in the new field of synthetic biology is an emerging view of cells as
assemblages of parts that can be put together to produce an organism with a desired phenotype
2].Over the long term, the approach will be used to synthesize increasingly novel designed genomes,
and may be a tool for bioterrorism and we need protections from military or terrorist misuse and
25-5-2010 A synthetic creation story :
3]. Will the newer synthetic biology help human mankind by detecting where is the defect lies the
human genome that give rise cancer or in formulation of new drug or vaccine?
4]. is it a step towards ... creation of living beings or artificial life with capacities and natures that could
never have naturally evolved."
5]. In Future Can some one will design for Human clone?
Nature Ne…nature.com/…/news.2010.261.html 5/7 comment 2010-05-25 08:14:52 AM  Posted by: Prof. Pranab Kumar Bhattacharya
References
1] Elizabeth Pennisi Synthetic Genome Brings New Life to Bacterium News of the Week Genomics:
Science 21 May 2010:Vol. 328. no. 5981, pp. 958 – 959 DOI: 10.1126/science.328.5981.958

2] R. L. Warren, J. D. Freeman, R. C. Levesque, D. E. Smailus, S. Flibotte, and R. A. Holt Transcriptionsof foreign DNA in Escherichia coli Genome Res. 18, 1798-1805. 2008

3] G. A. Benders, V. N. Noskov, E. A. Denisova, C. Lartigue, D . G. Gibson, N. AssadGarcia,
R. Y. Chuang, W. Carrera, M. Moodie, M. A. Algire, et a Cloning wholebacterial genomes in yeast. Nucleic Acids Res. 38, 2558-2569 2010

4] Tian,J., Gong,H., Sheng,N., Zhou,X., Gulari,E., Gao,X. andChurch,G. (2004) Accurate multiplex
gene synthesis fromprogrammable DNA microchips. Nature, 432, 1050–1054.

5] Mandecki,W. and Bolling,T.J. (1988) FokI method of genesynthesis. Gene, 68, 101–107.

6] *, William J. Blake Brad A. Chapman, Anuradha Zindal, Michael E. Lee, Shaun M. Lippow and BrianM. Baynes , Pair wise selection assembly for sequence-independent construction of long-length DNANucleic Acids Research, 2010, Vol. 38, No. 8P 2594–2602 Published online 1 March 2010
doi:10.1093/nar/gkq123

7] Gibson,D.G., Young,L., Chuang,R.Y., Venter,J.C.,Hutchison,C.A. III and Smith,H.O. (2009)
Enzymatic assembly ofDNA molecules up to several hundred kilo bases. Nat. Methods, 6, 343â
€“345,2009.

8] Gibson,D.G., Benders,G.A., Andrews-Pfannkoch,C.,Denisova,E.A., Baden-Tillson,H., Zaveri,J.,
Stockwell,T.B., Brownley,A., Thomas,D.W., Algire,M.A. et al Complete chemical synthesis, assembly,and cloning of a Mycoplasma genitalium genome., Science 319, 1215–1220.2008

9] Fraser, C. M., Gocayne, J. D., White, O., Adams, M. D., Clayton, R. A.,Fleischmann, R. D., Bult, C. J.,Kerlavage, A. R., Sutton, G., Kelley, J. M., et al. 1995) Science 270, 397–403.1995

10] John I. Glass, Nacyra Assad-Garcia, Nina Alperovich, Shibu Yooseph, Matthew R. Lewis, Mahir
Maruf,Clyde A. Hutchison III, Hamilton O. Smith*, and J. Craig Venter Essential genes of a minimal
bacterium, proceeding Nat Academy Science USA PNAS _ January 10, 2006 _ vol. 103 ,425-30
www.pnas.org_cgi_doi_10.1073_pnas.0510013103

11] Horgan, J. 1995. From Complexity to Perplexity. Scientific American. p107
 This comment is cited by 2
1] Synthetic Cells and Their Regulatory Challenges by J C Varela - Eur. J. Risk Reg., 2010 - Hein Online

Copy Right- Copy Right of the comment article belongs to Professor  Dr Pranab kumar Bhattacharya as per IPRCopy Right Rules. Please donot try to Infringe it by any means The Copy Right of this article  Title­"Synthetic DNA and artificial cell – what are the ethical issues its application in the real life and in human disease at cost of 400 million dollars Research" belongs only to Professor (Dr.) Pranab kumarBhattacharya MD(Calcutta Univ),  WBMES  and to those others whose name are mentioned   as co authors  in the article as   comments  in journal  Nature News   in chronology , as per copy Right rules of IPR-1996 applicable in India-2006 under  IPR law sections  306/301/3D/107/1201 (a),( b )and PIP  copy Right Acts of US 2012, SPARC authors amended Copy Right rules-2006  of US  when & if accepted for any other blogs, or as a reference, or for  publication in research journals  or in books  or  for next Research  on it or  reference material  or published as paper/article in any Indexed journal/journal  or as article in open access journals or as a commissioned article  the copy right clearance to be sought from authors  and then  also this article will be under RDF Copy Right rules of IPR of Prof(Dr.) P.K Bhattacharya. No person from any states of  any  country or from any places within India or any citizen of India or of Indian origin are forever   not authorized by Professor Pranab kumar Bhattacharya to use this article content ,  any  scientifically meaningful syllables/words  /sentences from this published  article as letter or  in the Blogs of Prof Pranab kumar Bhattacharya and that  in the journal Nature News   without his / future copy right  owner ‘s written permission  & copy Right clearance, even for any one’s personal knowledge  gain or for his/her fair use even/ dissemination of  any information/application in any field of medicine / pathology/ microbiology  ( Will be considered  then as Plagiarism by Prof P.K Bhattacharya) , [except such all permission is always remain granted to other authors ,their first degree blood relatives in what ever manner they want to use this article  for ever  
Now Posted as  Murshidabad Medical College Beharampur West Bengal , India
25-5-2010 A synthetic creation story : Nature Ne… nature.com/…/news.2010.261.html 6/7About NPG
Contact NPG
Privacy policy
Legal notice

COUNTER
25-5-2010 A synthetic creation story : Nature Ne…
nature.com/…/news.2010.261.html 7/7

Monday, 15 December 2014

Emergence of antibiotic-resistant bacterial strains,methicillin-resistant Staphylococcus aureus, extendedspectrum beta lactamases, and multi-drug resistance is a problem similar to global warming



 Revista da Sociedade Brasileira de Medicina Tropical 47(6):815-816, Nov-Dec, 2014
http://www.scielo.br/pdf/rsbmt/v47n6/0037-8682-rsbmt-47-06-815.pdf                                               

 Running Title -: Bhattacharya PK – MRSA problem  is similar to global warming

Address to: Dr. Pranab Kumar Bhattacharya. Dept. of Pathology/District
Medical College. Station Road 742101 Berhampore, Murshidabad,
West Bengal, India.
Phone: 91 92 3151-0435
e-mail: profpkb@yahoo.co.in

Received 11 June 2014
Accepted 26 November 2014

Emergence of antibiotic-resistant bacterial strains,methicillin-resistant Staphylococcus aureus, extended spectrum beta lactamases, and multi-drug resistance is a problem similar to global warming
                     Pranab Kumar Bhattacharya[1]
[1]. Department of Pathology, Murshidabad District Medical College, Berhampore, Murshidabad, West Bengal, India.

Dear Editor,
I recently read the article by Porto et al. entitled Active surveillance to determine the impact of methicillin resistance on mortality in patients with bacteremia and influences of the use of antibiotics on the development of MRSA infection, published in Revista da Sociedade Brasileira de Medicina Tropical/Journal of the Brazilian Society of Tropical Medicine[1].
Methicillin-resistant Staphylococcus aureus (MRSA) is a major pathogen worldwide in modern health care-associated infections. Within 1 year of introducing methicillin in clinical practice, MRSA strains were first detected in 1961 in Britain, followed by Denmark in 1963, and subsequently other parts of the world. MRSA is associated with increased morbidity and mortality from sepsis and rapidly develops multi-drug resistance (MDR). In a hospital-based study at Kolkata metro City by the author, MRSA showed in vitro drug resistance to co-trimoxazole (33%), erythromycin (75%), penicillin (22%), oxacillin (11%), ciprofloxacin (84%), mupirocin (8%), rifampicin (17%), and methicillin (85%); and MRSA also showed in vitro sensitivity to clindamycin (90%), cefotaxin (99%), vancomycin (100%) and linezolid (100%). Linezolid and vancomycin have been clinically used as reliable last resort drugs for MRSA treatment. Since 1997, vancomycin-intermediate and -resistant S. aureus and linezolid-resistant strains of S. aureus have been
reported[2,3]. Data on linezolid resistance from Asian countries, especially from the Indian subcontinent, are extremely rare, and Chakraborty et al.[4 ]found only a single case of linezolid resistant MRSA in a 33-year-old male patient with non-healing ulcers in a tertiary care medical college using polymerase chain reaction (PCR) to detect: I) mutations in the domain V region of one or more of the five copies of the 23S recombinant deoxyribonucleic acid (rDNA) gene; II) acquisition of the plasmid-mediated ribosomal methyl transferase Cfr gene, and III) deletion/mutation in the ribosomal protein L3 of peptidyl transferase center[5].
The prevalence of MRSA has increased in most private health care institutions, including Kolkata City of West Bengal, India, where it increased from 6.9% in 1988, to 54% in 2003, to 63% in 2013, varying from 8% to 71% across India[6].Resistance is due to an altered penicillin binding protein encoded by the mecA gene. MRSA can be confirmed using multiplex PCR-based detection of the mecA2 gene using the ATA3` mecA1 forward (5`GTAGAAATGACTGAACGTCCG) and reverse(5`CCATTCCACATTGTTTC) primers, as well as the oxacillin disk diffusion (ODD) and cefoxitin disk diffusion (CDD) tests.
Although considered the gold standard for MRSA diagnosis, PCR for the mecA gene is costly and requires a skilled technician; thus, many tertiary care hospitals and even medical colleges or private centers in West Bengal cannot afford to routinely perform PCR. ODD has a sensitivity of 97%, specificity of 95%, and an effectiveness of 97%; and CDD has sensitivity, specificity, and effectiveness of 100% for the diagnosis of MRSA infection when compared with PCR for mecA. In Kolkata, common causative organisms of hospital-acquired infections are Staphylococcus aureus, Streptococcus viridans, aerobic gram-negative bacilli such as Pseudomonas aeruginosa, Escherichia coli, and other MDR gram-negative organisms, including Acinobacter,
Klebsiella, E. coli, Salmonella, and extended spectrum beta lactamase (ESBL) enterobacteriaceae (E. coli and Klebsiella; prevalence,62-100%), and S. aureus, responsible for various mild to serious infections in multiple hospital units, leading to a higher median total hospital cost, longer hospital stay after infection (mean 22.9 days6), fatal sepsis, and death (mean 84%5). MRSA and methicillin-sensitive S. aureus strains with quinolone resistance have also been reported from an eye care hospital in Bhubaneswar, India7,8. Community-associated MRSA(CAMRSA) currently comprises 40-60% of all nosocomial S. aureus infections and cause sepsis at many centers worldwide, is one of the most prevalent significant pathogens, and causes a variety of infections from mild skin and soft tissue infections and necrotizing fasciitis to fatal sepsis. In one of our studies, when 336 individuals in the community were randomly screened from their deeper nasal cavity for persistence of S. auerus, the first 136 subjects showed no MRSA, whereas in the next 200 subjects, only 11%showed MRSA. In another study from Wardha, India, of 280 CAMRSA samples, 51.8% had the mecA gene[5]. CAMRSA colonizes the anterior nares, and nasal carriage of S. aureus acts as an endogenous reservoir for clinical infections in colonized individuals or as a source of cross colonization for community-based infections. Nasal S. auerus colonization is an important risk factor for life-threatening infections of the carrier. In our CAMRSA study, the overall incidence of S. aureus was 12-28%, even in healthy subjects: a higher prevalence may occur in overcrowded and slum areas.MRSA results in surgical site infection, non-healing ulcer, necrotizing fasciitis, pneumonia, urinary tract infection, and central venous catheter-associated infections. Due to use of previous third-generation antibiotics in critical care units, coagulase-negative staphylococci cause major infections, followed by Klebsiella pneumoniae, Pseudomonas aeruginosa, and non-albicans Candida -producing bio films in urinary catheters; nasogastric, parenteral nutrition, and tracheostomytubes; and mechanical ventilators. Risk factors and mortality rate are always higher with MRSA infection. Comorbid conditions that act as risk factors include cancer, heart disease, nephropathy, diabetes mellitus, chronic obstructive pulmonary disease, polytrauma, dyslipidemia, human immunodeficiency virus, cystic fibrosis, hepatitis, pulmonary emphysema, dialysis,and tobacco and marijuana smoking.
In 210 samples the neonatal intensive care unit of a tertiary care public hospital in Kolkata, the most common isolated bacteria causing sepsis (all with a high C-reactive protein value) included Klebsiella (42.3%), MRSA (32.1%), and coagulase-negative staphylococci (11.1%). Of the 44 MRSA infection cases, 2-15% showed resistance to amikacin, gentamycin, cloxacillin, ofloxacin, amoxicillin/clavulanic acid, levofloxacin, cefotaxine, and co-trimoxazole, in addition to vancomycin(100%)[ 4.]
Today, the persistent, indiscriminate, and inappropriate use of antibiotics and the increasing specter of antibiotic resistance are an emerging critical situation for healthcare. This situation needs immediate action with current anti-infective therapies in West Bengal. MDR organisms will continue to increase unless clinicians in most care hospitals and private practices improve the rational use of antibiotics. The matter is rendered increasingly complicated due to the presence of ESBL and carbapenamase-producing organisms due to the blinded use of third and fourth-generation antibiotics. The potential for misuse and abuse of antibiotics was recognized shortly after their introduction into West Bengal; this may have been further escalated by failure to obtain appropriate culture and in vitro sensitivity reports for lower respiratory and urinary tract infections and pus. Meropenem or tazobactam is routinely used as the choice first-line antibiotic in most private care hospitals and nursing homes and for some doctor’s prescriptions; this is due to kickbacks in the form of monetary commissions from pharmacy houses. We need urgent implementation of an effective antibiotic policy, and the basis of that policy rests on generating microbiological data and prescription audits through electronic prescriptions to be introduced to all public and private health care institutes(where approximately 60% of antimicrobial use is inappropriate) or at any geographical location where drug resistance has developed.
Antibiotic resistance is no less a problem than global warming. Moreover, the overuse of antibiotics causes the emergence of bacterial resistance and increases healthcare costs and sepsis-related deaths. We propose the development of a new global organization to lead the battle against antibiotic resistant
pathogens and call for this organization to be modeled on the organization created to combat global warming, the Intergovernmental Panel on Climate Change. This organization would be comprised of specialists in clinical and pathological medicine and include epidemiologists, microbiologists, pharmacologists, health economists, and international lawyers.

ACKNOWLEDGMENTS-:

The author acknowledges the following individuals for their help to carry out the work : Miss Upasana Bhattacharya,- only daughter of Prof. Dr. Pranab Kr Bhattacharya  * Mr .Rupak Bhattacharya, * Mr Ritwik Bhattacharya, * Miss Rupsa Bhattacharya, * Mr. Hindole Mukherjee, ** Mrs Dalia Mukherjee, ** Miss Oindrila Mukherjee, ** Miss Ayishi Mukherjee, *** Dr. Arya Sen and ***Prof. Pratip Kundu.
*7/51 purbapalli Sodepur Dist 24 Parganas(North) Kolkata110 ;West Bengal India ** Swamiji Nagar. South Habra, Dist 24 Pargnas(north), West Bengal, India ; *** Murshidabad District Medical college  Dept of Pathology and Dept of Microbiology

References
1. Porto JP, Santos RO, Gontijo Filho P, Ribas RM. Active surveillance to determine the impact of methicillin resistance on mortality in patients with bacteremia and influences of the use of antibiotics on the development of MRSA infection. Rev Soc Bras Med Trop 2013; 46:713-718.

2. Hiramtsu K, Hanaki H, Ino T, Yabuta K, Oguri T, Tenover FC.  Methicillin-resistant Staphylococcus aureus clinical strain with reduced vancomycin susceptibility. J Antimicrob Chemother 1997; 40:135-136.

3. Centers for Disease Control and Prevention (CDC). Staphylococcus aureus resistant to vancomyci--United States, 2002. MMWR Morb Mortal Wkly Rep 2002; 51:565-567.

4. Chakraborty B, Chakraborty B, Dopthap YP, Banerjee D.  LRSA suspect, taken to molecular court, PCR trialled, proven guilty. Ann Trop Med Public Health 2013; 6:653-657.

5. Mallick S, Kumar, Basak S. Accurate detection of methicillin resistant Staphylococcus aureus in day to day practice: a great help to clinicians. J Indian Med Assoc 2011; 109:892-895.

6. Bhattacharya S. Is screening for antibiotic-resistant bacteria justified in the Indian context? Indian J Med Microbiol 2011; 29:213-217.

7. Choudhury R, PandaS, SinghDV. Emergence and disseminationof antibiotic resistance: a global problem. Indian J Med Microbiol 2012; 30:384-390.

8. Choudhury R, PandaS, Sharma S, Singh DV. Staphylococcal infection, antibiotic resistance, and theraputics. In: Pana M, editor. Antibiotic resistant bacteria- a continuous challenge in the new
millennium. Chapter 10. In Tech; 2012. p. 247-272.

 The Copy Right of this article Emergence of antibiotic-resistant bacterial strains,methicillin-resistant Staphylococcus aureus, extendedspectrum beta lactamases, and multi-drug resistance is a problem similar to global warming strictly  belongs only to Professor (Dr.) Pranab kumarBhattacharya MD(Calcutta Univ),  WBMES  and to those others whose name are mentioned  in Acknowledgement  in the article as  Letter published in journal  Revista da Sociedade Brasileira de Medicina Tropical   in chronology , as per copy Right rules of IPR-1996 applicable in India-2006 under  IPR law sections  306/301/3D/107/1201 (a),( b )and PIP  copy Right Acts of US 2012, SPARC authors amended Copy Right rules-2006  of US  when & if accepted for any other blogs, or as a reference, or for  publication in research journals  or in books  or  for next Research  on it or  reference material  or published as paper/article in any Indexed journal/journal  or as article in open access journals or as a commissioned article  the copy right clearance to be sought from authors  and then  also this article will be under RDF Copy Right rules of IPR of Prof(Dr.) P.K Bhattacharya. No person from any states of  any  country or from any places within India or any citizen of India or of Indian origin are forever   not authorized by Professor Pranab kumar Bhattacharya to use this article content ,  any  scientifically meaningful syllables/words  /sentences from this published  article as letter or  in the Blogs of Prof Pranab kumar Bhattacharya and that  in the journal Revista da Sociedade Brasileira de Medicina Tropical   without his / future copy right  owner ‘s written permission  & copy Right clearance, even for any one’s personal knowledge  gain or for his/her fair use even/ dissemination of  any information/application in any field of medicine / pathology/ microbiology  ( Will be considered  then as Plagiarism by Prof P.K Bhattacharya) , [except such all permission is always remain granted to other authors ,their first degree blood relatives in what ever manner they want to use this article  for ever  
Now Posted as  Murshidabad Medical College Beharampur West Bengal , India
  Authors’ reply: Emergence of antibiotic-resistant bacterialstrains, methicillin-resistant Staphylococcus aureus andextended spectrum β-lactamases, and multi-drug resistance
are problems similar to global warming
Juliana Pena Porto[1], Deivid Willian da Fonseca Batistão[2] and Rosineide Marques Ribas[2]
[1]. Faculdade de Medicina, Universidade Federal de Uberlândia, Uberlândia, MG. [2]. Programa de Pós-Graduação em Imunologia e Parasitologia Aplicadas,
Universidade de Uberlândia, Uberlândia, MG.ly